-
Request from a user in the Getz lab: allow the prioritization order for mutation types to be customized. Eg., instead of the default:
```
De novo start out of frame/nonsense/nonstop
Missense/De n…
-
I am trying to make use codon to speed up few python functions.
Stuck with this error.
```
File "/anaconda3/lib/python3.9/site-packages/codon/decorator.py", line 218, in wrapped
return _…
-
Hi,
I am planning to merge GALBA result together with BRARKER3 by TSEBRA.
However, while running the standalone version of GALBA v1.0.11, I encountered an issue with five duplicated transcript ID…
-
Hey @philippbayer, I don't know how much you want me chipping in with these suggestions? Feel free to ignore this, or tell me to mind my own business :). At least on a github issue, I can post a longe…
-
Hi,
It could be interesting to extract the number of TAG, TAA, TGA used as STOP codon from Prodigal CDS prediction.
@ylana Do you think you can do that? You can take inspiration from the script `s…
-
In 8.7.2,
It introduces the method to check whether a codon is a start or end. However, the second code is not checking for the end codon
![Screenshot 2024-04-28 232035](https://github.com/GavinHu…
-
```
CalculateCodonSpecificRibosomeDensity
-
- [x] write about visualization.
- [x] Read background
Todos:
- [x] Title including transcript id, protein id & name
- [x] transcript tract: get exon lengths from `tx_coordinates.get_cds_regions…
ielis updated
2 months ago
-
Hi, as Prodigal v2.6.3, we observe with pyrodigal a difference in translation result for some start codon (TTG).
>nuc sequence (Lactobacillus)
TTGGGCATACCGGCTGAATACGTCTTATTCGACAGCTGTTTCTCTTCACCTAA…
-
```
$ codon run
setop updated
4 months ago