-
Hi,
i wanted to say thank you for making this alignment viewer, i really like it!
I have had some problems viewing MSAs of RNAs with modified residues.
The problem seems to be that with all the m…
-
```
What steps will reproduce the problem?
1. pagan -s 22918428.fst
What is the expected output? What do you see instead?
aligning node #1# (1/21): Burkholderia_mallei_NCTC_10229 - Burkholderia_mall…
-
At present it's hard-coded to using a nucleotide model, but it could be extended to using a codon or amino-acid model.
What lines in `dbga` are most pertinent to this?
-
Dear developers,
I want to express my appreciation for EndHiC, as it has proven to be an exceptionally fast software tool, surpassing the performance of other tools like 3d-dna. I am currently work…
-
Hey Martin,
Thanks for making this tool, I'm finding it very useful for my current project.
I have a profile hmm database obtained from CONJScan that I want to use to scan through a fasta file c…
-
Hi !
I don't know if this tool is still maintained so I try my luck.
Background: Testing Realphy by running it with a set of 11 samples of P. aeruginosa. I want to merge the alignment results fo…
-
Thanks for developing MOSAIK, I tried on a human dataset and get a Segmentation fault. Any hints?
Thank you!
## /home/snow/bin/MOSAIK/bin/MosaikAligner -in LID115260_MERGE1.mkb -out ../bamfiles/LID1…
-
**Bug Description**
`mafft` stdout/stderr implementation does not work in a Jupyterhub deployment.
**Screenshots**
```python
Running external command line application. This may print messages to…
-
I'm trying to merge reads with SeqPrep.
I have read 1:
```
@M01271:10:000000000-A3WGH:1:1101:15333:1723 1:N:0:1
GTTAATGTTTGGCTGCGAGGTCGGGGCGGACGGACGCTTCCTCCGCGGGTACCAGCAGGACGCCTATGATGGCGCTGACTACATCG…
-
[Steps in data analysis](http://barc.wi.mit.edu/education/hot_topics/ChIPseq_2016/AnalysisofChIP-seqData2016.pdf)
0. **Preprocessing**:
i) Bad quality -> Tool: Use “FASTQ Quality Filter” and/or …