-
@tnrich Tabbing is a non-intuitive mess. can we remove it or fix it? I'm noticing this is HDE but it should be an OVE issue right? It looks like a demo of draggable tabs, but it does not make sense to…
mfero updated
5 years ago
-
Linking experimental data to samples and genetic designs is becoming critical to many synthetic biology projects.
We thus propose to add two new classes, Experiment and ExperimentalData, to enable …
-
I think the current view options is close to being nice, but it is an awkward experience using that little view dropdown. I think a smoother experience would be to give each view tab a "title" and all…
-
Hi Jan,
I installed CRISPRAnalyzeR with docker on my local mac laptop without problem. But I got the crash issue when I tried to load the TRAIL_Resistance sample data.
Then I access the demo …
-
The input file is supposed to be like this:
row1: GENE_CLONE GENE Sample1 Sample2
row2: A1BG_CACCTTCGAGCTGCTGCGCG A1BG 94 713
But screens data are now analyzed with TKOv2 that contains the genom…
-
Hello,
I am attempting to utilize this program to analyze some amplicon data, but I'm having an issue parsing through this first few blocks of code because I don't need to convert anything from ab1…
-
Hello,
Thank you for developing this tool to analyse CRISPR screens!!! I've been analysing a preliminary experiment and found it very easy to use and so powerful. However I noticed that it often cras…
-
Update the following URL to point to the GitHub repository of
the package you wish to submit to _Bioconductor_
- Repository: https://github.com/jl354/bcSeq
Confirm the following by editing each…
jl354 updated
6 years ago
-
Unfortunately, I am trying to analyse a GeCKO result without any biological replicates. The analysis is quitting as edgeR has a strict 2 biological replicate requirement. Is there a way to switch off …
deb-m updated
7 years ago
-
Hi,
First I would like to thank developer group for coming up with a convenient and easily usable tool. I would like to ask a question rather than a issue regarding the software.
**Background:**…