-
Hello,
I was wondering if you could help me to identify biological reasons or issues in the sequencing explaining the lack of genomescope model convergence.
To give you some background we have d…
-
I am in the process of determining whether sourmash is the right tool for my metagenomic analyses. I am mostly using ONT data at the moment. Similar to previous posts (e.g. https://github.com/sourmash…
-
I am trying to install RSEM but not able to see software sub-directory. Moreover not sure what is $(your_favorite_location) in the clone command?
Please advice..
-
Turnbaugh, P. J.
Ridaura, V. K.
Faith, J. J.
Rey, F. E.
Knight, R.
Gordon, J. I.
2009.
The effect of diet on the human gut microbiome: a metagenomic analysis in humanized gnotobiotic mice
http://dx.d…
-
I have two batches of E.coli strains (individual colony isolates, illumina sequencing) that are very large (~1500 and ~1900 samples) and I want to use Unicycler hybrid assembly first, but if it fails,…
-
Hi,
I am relatively new to racon. I am trying to polish noisy long reads (pacbio) using hi-fidelity long reads (pacbio).
I am using pbmm2 (SMRT C++ wrapper for minimap2's C API) for alignment:
…
-
Which manufacturers' sequencing adapters are included in the reference database of FCS-adaptor? Does it include BGI's sequencing adapters (BGISEQ/MGISEQ)?
Forward filter: AAGTCGGAGGCCAAGCGGTCTTAGGAAG…
-
I ran jellyfish count on ccs reads produced from PacBio HiFi sequencing as follows:
```
jellyfish count -C -m 31 -s 1000 -t 10 -o marten.pb.jf m64047_240219_192555.ccs.fasta
```
And subsequent…
-
Hi,
Thanks for the convenient tools！I have some confusion for the results. It can be seen that the total copy number of smn in the figure is about 1. The last bar chart shows that smn1 has more c…
-
Here is an outline of a workflow that needs to be enabled in Galaxy to allow variant calling on HIV-1 datasets
- [ ] Upload all datasets for `PRJNA517147`
- [ ] QC with `fastqc` and `multiqc`
…