-
Hello,
I have managed to run metacoag on 9/10 flye-based nanopore assemblies, but I get the following error on one of my samples:
Is it maybe related to the low number of contigs with marker genes…
-
Dear Mahul, I intend to use SVMU for calling variants between a reference and a newly sequenced strain of Drosophila. I have the contigs and also a scaffolded assembly for the same built from Illumina…
-
### Is your feature request related to a problem? Please describe. For generic questions use Q&A section in the Discussions forum above.
Hello,
I have to submit some genomes to ENA (European Nucleot…
-
Hi Linxing:
Thank you for developing this nice tool! I am curious about what's the functions does COBRA have in the classic virome pipeline as it's a new software.
For example, I used MEGAHIT to get…
-
# Please report
- [ ] version of ABySS with `abyss-pe version`
```
abyss-pe (ABySS) 2.3.1
```
- [ ] distribution of Linux with `lsb_release -d`
```
CentOS Linux release 7.4.1708 (Core)
```
…
kmnip updated
2 years ago
-
Hi Zeng,
Is it possible to allow for discordant contigs in the BAM and VCF files used?
In trying to run GetBaseCounts on a BAM file from GDC, which is aligned to some version of hg38, I get:
`[E…
-
>NODE_1_length_151949_cov_17.818703
ACGGATGTCAGTAGCAATAACGGGCATGAAAAGTGACACTGTCACTGATATTCTCAAGGCTGACGAAGCCATTCCAGTAAGCGGCGCATCGCTGGCGACAGGCTGGCGTCATCCTGGTAGCACAGGCACAAACGGCGCTGCGCCCAGCGGTCCTGTAACCCGA…
-
Laura Carroll has volunteered
-
I was wondering if there is a stats file that tells you the percent of total assembled configs that went into the final MAGs? If not, do you know how I might find that number?
-
This should be relatively simple - we'd need to read the ##sequence-region info at the top of the gff to define the lengths of each chromosome. This has been requested by team133, so it would also nee…