-
Hi,
I using kb to align my library with pre-built indexes, and analyzing it using transcript to genes file from the same source.
In a different issue I was told to use kallisto bus instead, so I bu…
-
I encountered the similar error as in [issue 162](https://github.com/marbl/verkko/issues/162#issue-1782465174).
```
UntipRelative
Unitigify 3
Combine mappings
Combine edges
Find lengths
Fix c…
ghost updated
10 months ago
-
Hello @jermp!
I'm trying to build fulgor and I got such compilation problem on several machines using gcc11 and 12
In file included from /home/malfoy/devel/fulgor/tools/../include/index.hpp:6,
…
-
Hi, I'm new to this field, I was recently reading an article called "Phables: from fragmented assemblies to high quality bacteriophage genomes" and I wanted to reproduce some of the results, however, …
-
## Problem Overview:
When using the SingleLetterAA plugin to process the following input, an incorrect result is obtained.
Input:
### objectivec
```
chr7 55242469 . TTAAGAGAAGCAACATCTC T . PASS…
-
Hello!
I'm interested in using `cuttlefish 1.0` because of your approach to coloring that yields monochromatic unitigs. I was wondering if you had any suggestions for ways I could color by input f…
-
Running into an issue of MBG crashing when running ribotin on chm13 and specifying verkko nodes for each acro cluster. The first
cluster completes successfully, the next crashes. Wasn't sure if I sho…
-
input (the first k-mer is the reverse complement of the second):
```fasta
>two_complemental_kmers
AAAAGCCTGAGAAGATATCTTCTCAGGCTTTT
```
command:
```
$ cuttlefish build -s test.fa -k 31 -t 8 -…
-
Hey!
I was trying to build a graph of 400K bacterial genomes and got the following error:
```
terminate called after throwing an instance of 'std::runtime_error'
what(): num_contigs must be l…
-
Problem: visualize the pseudoalignments: `kallisto quant -i transcripts.idx -b 30 -o kallisto_out --genomebam --gtf transcripts.gtf.gz --chromosomes chrom.txt reads_1.fastq.gz reads_2.fastq.gz`
Out…