-
There is an [alternative UMI protocol](https://www.protocols.io/view/guide-seq-simplified-library-preparation-protocol-wikfccw) for the original GUIDEseq protocol, [github here](https://github.com/npp…
-
Unfortunately, when I try and follow the tutorial available from CRAN, the function `run_sgrna_quant` was not found. Could you resolve this issue?
-
Hi,
I am trying to design gRNA to revert a SNP.
I realized that the designed gRNA has the wild-type allele of the SNP. I guess that this mismatch will not affect the gRNA binding to the target locus…
-
Hello,
My code looks like this:
`plots
-
Hi,
I need some clarification for assessing NHEJ editing. I don't personally run the analysis so pardon my non-technical descriptions. We currently use the batch mode to analyze our genome editing …
-
Hello, I using samtools mpileup to find snp or indel according BAM file,and I need to find all the reads changes in the bam file, but the tool seems to filter them out automatically.
What can I do fo…
-
Hi,
I am trying to design a gRNA for base editor SA(KKH)-BE3 (pam:NNNRRT).
The sequence flanking my SNP ( bold C) from file 01_sequences/dbedntmuts.fa is GAAATGTTTGAGGATGACTCCT**C**GCAGCCTGGTCCC…
-
We need to check whether the sequencing data for Yeast States actually shows that the gRNA strains were reversed. If so, talk with Aptima and DARPA about the issue. If not, correct the sequence.
-
Hi, I tried to include a new BE in dbepams.tsv, however the guide selection behavior is somewhat strange. My understanding was that a wider windows achieved by changing distance of mutation (or codon)…
-
Hi, this is not really an issue but a question. My understanding was positive control guides would introduce non-sense mutations. However, in a run i did, it is returning a number of guides only a fra…