-
Hi Cyril,
Thanks for your work - codonDT has the potential to be quite useful for our work.
I have matched riboseq and rnaseq data. I've run a test sample with only the riboseq to completion. …
-
**Are you using the latest release?**
Yep :)
```
funannotate --version
funannotate v1.8.15
```
**Describe the bug**
I get the following error message (in logfile section below) when running the…
-
### Description of the bug
The bug occurs due to unrecognized arguments passed to the `seqcluster` command. It expects input files in a specific format but receives unexpected arguments, causing te…
-
**Are you using the latest release?**
`funannotate v1.8.11`.
**Describe the bug**
funannotate test is failing at the predict step with error "Not enough gene models 175 to train Augustus (200 re…
-
The Definition, Expected Value, Value Syntax and Example fields all appear to have been swapped between "Assembly Software" and "Assembly Quality" terms, i.e the expected value for Assembly software s…
-
Hello,
I'm trying to follow your MAmBA test code using the following command after downloading the files from https://sites.google.com/a/uniroma1.it/valeriofulci-eng/software :
_/mamba.sh -a TGG…
-
Dear author,
I got my results csv file with empty Gene-Ontology-Term and Interpro-ID (Description) fields. I am wondering how I can add those fields to the results, especially the GO term. I only u…
-
Please, describe below the problem you think we face in the miRNA/isomiR naming.
Try to summarize it in 200 words. The current discussions are here:
* isomirs : https://github.com/miRTop/incubat…
-
I am trying to quantify RNA reads from SlideSeqV2 data using a custom technology string (-x ) and a kallisto index (_version 0.50.1_) with help of the kb count (_kb_python 0.28.2_) command. The total …
-
Hi cutadapt,
I get the below output fastq when running cutadapt command (v4.2, installed via LSF module/compilation with gcc 11.3.0)
`cutadapt -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A AGATCGGAAGAG…