-
### Project short name: Covid19BALFLandscape
### Primary Wrangler:
Arsenios
### Secondary Wrangler:
Ida
### Associated files
* Google Drive: [folder](https://drive.google.com/drive/folders/1Ua…
-
Which manufacturers' sequencing adapters are included in the reference database of FCS-adaptor? Does it include BGI's sequencing adapters (BGISEQ/MGISEQ)?
Forward filter: AAGTCGGAGGCCAAGCGGTCTTAGGAAG…
-
goodnight,
It is not possible to use the extension in Chrome, I load it in developer mode but a message appears that it is not listed in the store, and therefore the extension button does not appea…
-
```
c=Cube("/scratch/DataCube/v1.0.2/esdc-8d-0.25deg-46x90x90-1.0.2_1/")
d=getCubeData(c,variable=["fapar_tip", "gross_primary_productivity", "transpiration"],time=2001:2011, region="Europe")
fun…
-
Creating folders if necessary...
Running CRISPR array search, it may take a while...
Running CRISPR cas search, it may take a while...
Working with 5 files
Working with file 1 - TARA_Cas9…
-
Hi.
I built an assembly and I am trying to polish it with apollo.
I installed it as told, and followed all the steps.
I converted the fastq files into fasta one-liners
head reads2.fasta
>V3000661…
-
![微信图片_20240314165254](https://github.com/BGI-shenzhen/LDBlockShow/assets/86965493/fce69d7c-006d-43e4-b078-40d1dc4caea3)
Hi,
I found some SNP/Indel sites were filtered, can I rescue them by certai…
tydcg updated
1 month ago
-
I still get this error using `find` on USB key:
```
$ find /f/ProgramsPlus -name "*bgi*"
find: failed to read f…
-
Hi.
I noticed that on the SEQanswers forum a document from BGI has been posted that lists all sequences for the oligos and primers used for BGISEQ/DNBSEQ/MGISEQ library preparation.
See [here](http:…
-
it will help automating the script if we can.
This task is part of Story #617