-
This works here:
http://localhost:8080/apollo/sequence/bee/Group9.10:3995589..3999237
but using a remote sequence does not:
http://localhost:8080/apollo/sequence/Remotefly/2L:1..235
get…
-
Hi David,
When I try to run orthofinder, I get an error that it can't run diamond makeblastdb or blastp and to check my path. However, when I check my path using which, diamond pops up, and I am ab…
-
` {
"alleleId": "FB:FBal0031493",
"assembly": "R6.28",
"chromosome": "3R",
"end": 4346199,
"genomicVariantSequence": "N/A",
"paddedBase": "T",
"refe…
-
Hi,
Thank you for Ra and Raven.
Ra v0.2.1
Raven v0.0.3
I have a diploid genome for which other assemblers would juxtapose the two haplotypes instead of "crushing" them. I tested Ra and was …
-
The following read triggers a segmentation fault (apparently at alignment time).
`TCTCATTCTGTCTTATTTTACCGCAACCCCAAATCGACAATGCACGACAAAGGAAGCAGAACAGATATTTAGATTGCCTCTCGTTTTCTCTCCCATATTA`
-
When I did the dry-run, the pipeline seems working, but when I run it, I got some errors related to star. The error is as followed:
Traceback (most recent call last):
File "/home/yixin/Desktop/s…
-
Hello,
I wonder how to consider replicates, since from the alignment process (STAR in my case) only one file of the channel `trimmed_reads` are taken in account. Just after I put a trace of the wo…
-
when I used hicFindTADs to detecte TADs，The following parameters that I couldn't understand . minDepth and maxDepth, The software's suggestion just a range.so when I try different parameters, the resu…
-
arXiv论文跟踪
-
Update the following URL to point to the GitHub repository of
the package you wish to submit to _Bioconductor_
- Repository: https://github.com/guldenolgun/NoRCE
Confirm the following by editin…