-
# Issue Report: std::runtime_error (core dumped) with Dorado 0.7.2
## The issue:
I have basecalled my data (short read amplicon data) with several versions of Dorado and keep on having the same (…
-
Hello!
When I was using scTE, I encountered some problems and I wonder if I can get some advice.
### Question 1: Preprocessing BAM Files with Filtered Barcodes from CellRanger Output
I'm ex…
-
-
I'm following the "[read the docks](https://cumulus.readthedocs.io/en/stable/cellranger/fixed_rna_profiling.html)" input protocol for the CSV file and other Terra inputs and am receiving an error rela…
-
Hi,
The function `find_nonambient_barcodes` lists the input requirement:
`orig_cell_bcs (iterable of str): Strings of initially-called cell barcodes.`
However, because the default meaning of …
-
Hi,
I have been having issues recovering the same amount of cell barcodes post correction in salmon alevin compared to cell ranger. Maybe alevin-fry can help in this task?
**What I have**
- scRNA…
-
I am noticing that I am losing over 50% of my reads because they are tagged with cell-barcodes that aren't "core" or aren't 1 edit distance away from a "core" cell-barcode. Some of the non-core cell-b…
-
I have fastq files for scDNA with barcodes extracted in the headers, in the RG:Z field.
```
@A01789:135:HLKCJDMXY:1:1101:1027:1047 RG:Z:CGTGCCTATTCGGACAGT
TTAAATTGGTATCAGAAGAAACCAGGGAAAGCCCCTAAG…
-
UnicodeDecodeError: 'utf-8' codec can't decode byte 0xa7 in position 0: invalid start byte
When running with the repeat mask file, it always report the errors, and I do not know why.
$ velo…
-
CellClones class should have barcodes and cell types. Clones could be constructed afterwards. Some algorithms take barcodes and cell types as inputs, while other might take clones (could be reconstruc…