-
@GitHubRulesOK
This topic has already been opened a long time ago by me and others, but I think it has been forgotten, and I do not intend to open a duplicate topic but only to remind the developer o…
-
Dear shujun，
First of all apologize for my bad English. I have sequenced dozens species, these species belong to the same genus (eg. wild, cultivars, landrances), and I will construct a pan-genome. S…
-
**Procedure to reproduce bug:-**
1. open emojipicker
2. choose icon - "family Wwb" - - (https://cdn.jsdelivr.net/emojione/assets/3.1/png/32/1f469-1f469-1f466.png)
3. now focusout from "emojion…
-
Hello,
I am getting this error while running RepeatCraft with the output obtained from RepeatMasker 4.0.9:
```
Step 1: Reformating GFF...
Parsing LTR_FINDER GFF...
Step 2: Labelling short…
-
Buenos días, he detectado sobre dos ordenadores MAC diferentes que el plugin se abre, permite la selección de municipios y elementos a descargar, pero al iniciar la descarga se queda bloqueado siempre…
-
sh: line 2: 2474030 Aborted bash -c 'timeout 188s /home/omendivi/.conda/envs/EDTA_1.9.9/bin/blastn -query TE_00071658_INT#LTR/unknown
TCTGGTATCAGAGCAATCATTCCAGGGGATTTGTTCTATGTCTTTTTTT…
-
This is a catch-all issue for the initial component selection. Keep this table up to date:
| Type | Component Name …
-
### Provide your feedback here.
https://github.com/adobe/react-spectrum/blob/fa11f1726881eaa5e73bf43178b57161ba2c61e9/packages/%40react-aria/i18n/src/useDefaultLocale.ts#L30
I'm looking at this co…
-
Although there is an `onlyDirection` option in `.postcssrc.js` for us to config, it can only receive `ltr` or `rtl` string explicitly. We couldn't dynamically pass a value based on the html lang attr…
-
### Lexical version:
@lexical/react 0.10.0
lexical 0.10.0
as well with
@lexical/react 0.12.2
lexical 0.12.2
### Problem
Unexpected style for generated html `table` using `$generateHtmlFromN…