-
## Bug Report
### Affected tool
Mutect2
### Affected versions
- [x] Latest public release version 4.1.8.1
- [x] Latest master branch as of 9/20/2020
### Description
Mutect2’s header defi…
-
I have been running four analyses for one phenotype; all samples, females only, males only and females vs. male cases, using SAIGE version 1.3.1.
For one analysis (females only) and two chromosome…
sboer updated
3 months ago
-
Hello,
When working with a large VCF, iterating all features to determine the total variant count is slow. Can Can HTSJDK use a VCF index to quickly count total records in a VCF?
Thanks
-
Should we allow the ability to upload patient and parent exomes as 3 separate VCF files rather than a multi-sample. Or is it easy enough for people to use vcf_merge?
-
Hi all. I am trying to import data from a VCF produced by GATK Haplotypecaller. The VarientExperiment constructor fails from both VCF or GDS. Reproduced with the GDS:
```R
ve = VariantExperiment::…
-
Hi,
I am new to Long reads seq and Deepvariant i tried to to WGS Variant calling steps from Alignment ( pbmm2 ) from GIAB data and Variant Call through Deepvariant Singularity Image ( singularity p…
-
Hi,
Thank you for developing this tool which is quite easy to use!
I am wondering if SpecHLA could also be used to detect somatic HLA mutations since we have paired tumor and normal WES or RNA…
-
I want to construct a graph from reference and SV vcf called with `sniffles`.
I just keep one variant record as follow:
```
Chr1 295261 17 GTCAACTGGCTGCTGGCGCAGTGGTAGCGCCAGCAGCCAGCCCTGCCTCCCTTTGT…
-
Hi I am trying to extract snp from my snp and I have used V2.1&2.2 bench, there is a same error.
cmdline: python hisat2_extract_snps_haplotypes_VCF.py "/media/wgs/reference/Homo_sapiens_assembly38.…
-
```
As a one way automated copy feature, vcardio could autoimport all vcf
files in a certain predefind directory on start (or better -
periodically).
In conjuction with, for example, swiftp - ftp s…