-
Hi,
I use abPOA to produce multiple consensus sequence, three most frequency sequences are
> 1 with a depth 25
CCCTCCCTTCCTTTCTTTCTCTCTTTCTCCCTCTCTTTCTCTTTCATTTTTCCTC
> 2 with a depth 40
CCCTTC…
-
Hello, I am using HiTE to annotate transposons. However, I did not provide a database such as repbase. I found that the values of the matching repeat columns in the results seemed to be randomly gener…
-
First of all, amazing work! I've been hoping for something like this for quite some time!
It seems like users upload consensus sequences, which is standard at the moment, but is there any interest …
-
Hi,
I tried to run TEtrimmer with the test set, using the command:
**TEtrimmer --input_file test_input.fa --genome_file test_genome.fasta --output_dir test_output --num_threads 20 --classify_all…
-
#### System information
Geth version: `v1.10.3`
Quorum version: `v24.4.1`
OS & Version: Linux
#### Expected behaviour
I used a simple contract that adds and removes validators from a list. Th…
-
Following up on https://github.com/ordinals/ord/issues/2574.
## Objective
The primary objective is to create a robust mechanism for ensuring data integrity and consistency across ordinal indexer…
-
Hello,
I would like to ask if the consensus sequences of delly's output are human or just unknown insertion sequences (maybe virus or bacteria ones).
Thank you.
-
We're having a trouble with the bash script to for generating consensus sequences. It runs without errors, and generates a file for each locus, but each of those files is blank.
Does anyone hav…
-
Extend the transaction validation helper with the following checks:
- Inputs array is not empty
- Outputs array is not empty
- Transaction can be mined (it is in its final state)
Preliminary rea…
m-kus updated
8 hours ago
-
Dear,
I'm running nextclade when analysing RSV, but I want to change reference, so I run
```
nextclade-x86_64-unknown-linux-gnu run \
-r ../data/general_data/ref/reference_seq.fasta \
-m ../d…