-
Analysis of simulated validation data by the CARD team (unpublished) revealed that Prodigal undercalls ORFs when the _-split_prodigal_jobs_ option is used. This was particularly noticeable in a _Acine…
-
Hi, I'm trying the viralFlye pipeline for the first time today, starting with the directory from metaFlye output and the reads. My input command is the following:
~/tools/viralFlye/viralFlye.py --d…
-
Hello,
I am trying to use metaphor with my data. I installed it in a cluster (NAME="CentOS Linux", VERSION="8", PLATFORM_ID="platform:el8") using conda. I used DFAST with the default configuration, a…
-
Anacaonda3
Python 3.7
Windows 10
In the process of installing deepBGC get an error message that the package can't be installed because hmmer and Prodigal are not accessible. Any clarificatio…
-
I am currently trying to run MTase linker in v0.4.11. The snakemake commands are failing because spaces are introduced through the workflow. These spaces make all jobs fail.
Command ran:
```
nan…
-
Hi, as Prodigal v2.6.3, we observe with pyrodigal a difference in translation result for some start codon (TTG).
>nuc sequence (Lactobacillus)
TTGGGCATACCGGCTGAATACGTCTTATTCGACAGCTGTTTCTCTTCACCTAA…
-
A small project to improve anvi'o, based upon feedback/ideas @FlorianTrigodet and I heard from our colleagues at the QIB in Norwich.
## The need
There is interest in being able to use alternativ…
-
- Prodigal is pretty fast, however, gene `annotation` is missing. Only `gene-calling` done
-
Hi,
I'm running `snapt` on a closed bacterial genome. It's running fine until the `CURATE NON_CODING TRANSCRIPTS` step, for which `prodigal` compains about a sequence being too short.
Do you have a…
-
Can I use _Prodigal_ to **predict fungal genes**?