-
Hi, Brain
I am sorry to bother you, I have a small question which I can not solved.
My trinity version is 2.12.0. When I run at second phase, the 'ReadsToTranscripts' script always error.
This is…
-
### Describe the bug
I have found that the *Add | New Scaffolder Item | Razor Pages using Entity Framework (CRUD)* command fails more often that it succeeds. In fact, I'd say it fails initially clos…
-
Dear the author,
Thank you for developing such a useful program. I have been using GapFiller to fill gaps in my genome assembly at the scaffold level. However, I found that, although I achieved a…
-
Dear the authors,
Thank you for developing such a useful program. I have been using GapFiller to fill gaps in my genome assembly at the scaffold level. However, I found that using different lengths…
-
# Please report
- [ ] version of ABySS with `abyss-pe version`
- [ ] (abyss) [juaguila@u01 abyss-763]$ abyss-pe version
bash: line 0: test: -le: unary operator expected
abyss-pe (ABySS) 2.3.7
W…
-
Hi all, I wanted to share with you some of the changes that are coming for beta-5 of MVC and some of the rationale about why we're changing `[Activate]`
## What's changing
We're removing `[Activate]`…
-
## Bug Report
#### What did you do?
operator-sdk create api --group api --version v1 --kind License
INFO[0000] Create Resource [y/n]
y
INFO[0002] Create Controller [y/…
-
I am writing to inquire about the possibility of obtaining scaffold circularity information from a .gfa file and incorporating it into the .fasta file headers. I have discovered that the --seq-report …
-
Hello Florian,
unfortunately, I have to bug you once again... I applied RNAlien on the following Sequence:
```
>1
AGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACAGGAAT…
riasc updated
4 months ago
-
Hi,
I'm trying to forge with Saccharomyces Cerevisiae BY4743 downloaded from here (https://www.atcc.org/products/201390).
The issues is that this strain is not registered in either NCBI or UCSC.
…