-
2GB of RAM ain't enough when your FASTQ files are >11GB in size, like from a NovaSeq.
This line:
https://github.com/theiagen/public_health_viral_genomics/blob/main/tasks/quality_control/task_fa…
-
### Operating System
Windows 10
### Other Linux
_No response_
### Workflow Version
wf-amplicon v1.1.0
### Workflow Execution
EPI2ME Desktop (Local)
### Other workflow execution
_No response_
…
-
### Description of the bug
This is the output that is seen on the terminal once the pipeline has failed after `GATK4_MARKDUPLICATES`, my guess is that one of the later join operator is causing the …
-
### Description of the bug
I am trying to launch a methylseq run using the latest `dev` branch where some (but not a all) samples require merging of technical replicates before launching. If I unders…
-
I recently created an issue:
https://github.com/ablab/spades/issues/413
That I closed because I thought the problem was tabs in the seqname. I didn't see the full error before and it turns out the…
-
does this library support the fastq format:
https://en.wikipedia.org/wiki/FASTQ_format
-
Hi,
During the simulation of ultra-long ONT reads, an error was encountered: "fastq is too long. Max acceptable length is 1000000."
Will the program be updated?
Best.
-
Hi,
I found an error when I use pyfastx.Fastq to parsing the long read FASTQ file.
The read.name untimely appearance in the end of read.seq string, such as 'GGCATTTTTCCGTTTGTCACTTCTTCTTCGCTATCCTGTT@…
-
Dear author,
I want to ask what is the default fastq file, only foward reads or reverse reads or interleaved reads?
Thanks,
Jianshu
-
Hello,
Since I have interleaved reads ready to use, I was wondering if it is ok to use them instead of concatenating the reads or it would cause problems down the line?
Thanks!