-
Hello Dr. Maria Nattestad,
I am a PhD student researching Mycobacterium tuberculosis genomes with long read sequencing. Assemblytics is one of the variant callers we are using to study structural …
-
Hi,
I tried to run --snp_dist but encountered the error in below.
Could you help me to resolve this issue ?
(tb-profiler) kansensho@MAC:/mnt/d/RIT_fastq_20221213_MTBseq$ tb-profiler version
…
-
NTR: perturbation of host inflammasome-mediated signal transduction
-
- 'symbiont defense to host-produced reactive oxygen species'
- 'effector-mediated defense to host-produced reactive oxygen species'
- 'symbiont defense to host-produced nitric oxide' >> symbiont-…
-
Hi,
I generated my vcf files from GATK pipeline using ploidy 1 as it is a mycobacterium tuberculosis genome. Now i want to annotate my variants using snpEFF and Annovar. I search snpEff database for …
-
why I still met error when run command to download reference genome although I used clockwork_container.img?
-
I have successfully installed Tormes-1.3.0 using conda, and it functions properly for individual genome analyses. However, when I attempt to process multiple genomes simultaneously, I encounter an iss…
-
## Expected Behavior
Aligning human AlphaFold proteome to the Mycobacterium tuberculosis proteome
## Current Behavior
Index table: counting k-mers
/data/local/vfranke/VFranke_Structures/TMP/…
-
Due to differences in Mycobacterium tuberculosis species reporting in the Afanc report compared to the Mykrobe report, TB samples are failing to pass to gnomonicus
E.g.
Mykrobe top hit: Mycobacter…
-
```
>c9effcbc-21fe-4869-8020-c22d0bc9bf37
TACGAACTTCGTTGAAGCAAACAGCCGTCATAAGGAAATTTTCGACAATAAATTTCGCACAGAAGAGGATCCCCAGGAAGAAGAATTTTATCAGCAATTTCACCTTGCTTAAGCGGCAATATGGATAGACATAGTTTATGATACAAAGAGCGACC…