-
I am trying to use flye for targeted assembly of ONT reads to manually fill gaps in T2T assemblies by assembling the flanking and soft-clipped reads aligned at a gap. This works pretty well except for…
-
A question that will become important when we add flanking site automation: is there any way to distinguish between a part that already has a flanking site vs. a part that has an illegal cut site that…
-
Can I know when flames match flanking sequence `CTACACGACGCTCTTCCGATCT,` do they allow matching with an edit distance or it has to be exact match?
-
Hi I'm trying to implement custom sharding on iOS. Without a custom sharding json file, i'm able to run tests using github actions. However with custom sharding the name of the xctestrun file changes …
-
Hello:
How should I solve this error:
```r
library(GenomicRanges)
library(genomation)
cpg.file=system.file("extdata", "cpgi.hg18.bed.txt",
package = "m…
-
**Describe the bug**
An annotated test method that exists in a class annotated with `@RunWith(Parameterized::class)` will not be included in a test run that is filtered with `test-targets` to inclu…
-
**Summary:** Potential bug report. AFAICT the calculation of the U vector is incorrect: it's not orthogonal to the fire front, and that causes systematic bias in computing fireline intensity (FLI). Th…
-
I would like to explore if it's possible to run (trigger?) Flank (https://flank.github.io/flank/) in the GitHub Action (which now works fine otherwise),
i.e. `./gradlew :engine:runFlank` etc.
a…
-
**Describe the feature you'd like**
When Vicewinder is pressed, I'd like for Twinfang to only replace the "left" or "flank" abilities when requirements for execution are met, while Twinblood only rep…
-
Hello!
I would love your opinion or advice with our method, and I have a few questions about how UMItools extract with a regex works.
I have nanopore long reads with dual 18bp UMIs, one on eac…