-
In a gVCF file for one individual, the variant calls can be inconsistent in itself. An extract of this can be found below:
```
1 10403 . ACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAAC A CIGAR…
-
During loading an avro file into HBase, expand all regions in the gVCF.
At the end each base should be covered.
-
-
HaplotypeCaller
Call germline SNPs and indels via local re-assembly of haplotypes
Overview
The HaplotypeCaller is capable of calling SNPs and indels simultaneously via local de-novo assembly of haplot…
-
Add support for converting REF blocks to homozygous reference loci for gVCF.
See https://gatk.broadinstitute.org/hc/en-us/articles/360035531812-GVCF-Genomic-Variant-Call-Format for details.
-
Hi!
Thank you for providing this tool.
I encountered a minor issue while using GLnexus and would like to seek your guidance.
Initially, I used GLnexus to merge five datasets, each consisting …
-
Hi there,
I have a question regarding genotyping GVCFs that were generated from other vendors.
For example, can I use GVCFs from Sentieon to jointly genotype variants using GLNexus?
What imp…
-
This is a follow up from an email thread with @pichuan, where DeepVariant correctly produces only hemizygous genotypes in regions indicated as PAR, but through GLnexus merging and later imputation can…
-
Hi All,
I have 40 gvcfs file generated from deepvariant and was combining them using GLnexus
here is my sbatch file
#SBATCH -J GLnexus
#SBATCH -p normal
#SBATCH -N 5
#SBATCH -n 11
#SBATC…
-
Hi! Im doing bcftools mile up and call for obtaining gVCFs for each sample. I call them separately because of time computing. As reduced example:
bcftools mpileup --threads 8 -a AD,DP,SP -Ou -f $ref…