-
I use conda to install LTR_retriever :
conda create -n LTR_retriever
source activate LTR_retriever
conda install -c conda-forge perl perl-text-soundex
conda install -c bioconda cd-hit repeatmasker…
-
Hi there,
I've been trying to generate a good assembly of a bee (flye v2.8.1 in fresh conda env, Ubuntu 20.04), ~250Mb genome size , containing a fair amount (~18%) of LTR etc retrotransposons. I h…
-
This is the list from the publication, but I don't think these are annotated in the sequence:
(Deleted table
See new table below with stand info.)
-
Hi,
I am getting an error causing pre-maturation of the pipeline
Here is my R script
-------------------------------------------
library(LTRpred)
LTRpred(genome.file = "felv.fasta")
----…
-
In the final annotation file *EDTA.intact.gff3., a few elements with the same sequence but different id were found, for example:
![image](https://user-images.githubusercontent.com/33917223/11550819…
khjia updated
3 years ago
-
Hi Shujun,
First thank you very much for EDTA!
I have been using EDTA to identify TEs in a set of fungal genomes. I am using a self-made singularity container for this because I am running this…
reslp updated
3 years ago
-
In the final library file `*.EDTA.TElib.fa.`, a few elements with the same id but different sequence were found, for example:
```
>TE_00000453_#LTR/unknown
AATTTTGTTAAATGGTTTTCATCACAATGGTGCCGATAAGT…
-
Hi,
EDTA found lots of unknown TEs, just wondering what would have flagged these as TEs in the first place if they have unknown? Repeat content? I want to be able to say something like "TEs categoriz…
-
Hello Hyphy team,
I am a new user of GARD and I am currently analysing the LTR sequences of LTR retrotransposons. The LTRs are non-coding sequences, and so, based on other posts here for running GA…
-
I am running into an issue where zeroinfl will not work because my data is not in integer form. I'm a little confused because I thought Poisson models could be used with continuous/rate data. Is there…