-
When running the commands under the section "Prediction" at http://kplogo.wi.mit.edu/manual.html#examples, I get a segmentation fault after the second command.
I've tried this on CentOS 6 and from …
-
Hi I am using crispr guided to a target region. we then sequenced the genomic dna (pcr product) that targets this region using miseq 2x250 + 10bp Index1 + 8bp Index2 (as defined in my previous questio…
-
Dear all,
currently we work on increasing the speed of the FASTQ data extraction and mapping.
We expect a speed increase by 4-9x compared to the current implementation.
I will close this once it …
-
The vignette recommends the usage of Bowtie 2 to map gRNAs to the library sequences. However, there are a number of issues on Bowtie 2's [tracker](https://github.com/BenLangmead/bowtie2/issues) highli…
-
Deepak: Could you please look into it in case there is any problem.
20150626 email:
Ye Chu (ye.chu.test@gmail.com) sent a message using the contact form at
http://www.peanutbase.org/contact.
I was t…
-
To reproduce, use Fasta file:
> s1
> GGCCGACCTGTCGCTGACGCAGG
Use input file:
NNNNNNNNNNNNNNNNNNNNNNN
GGCCGACCTGTCGCTGACGCAGG 5
Get a segmentation fault. However, if we use Fasta file, it works.
>…