-
### Description of bug
Dear developer and community,
I am reporting an error -9 that I get when I try to assemble shotgun sequences for Myxomycetes.
I have no problems assembling sequences on…
-
## Expected Behavior
easy-cluster should finish execution without errors
## Current Behavior
mmseqs easy-cluster errors and crashes with:
Error: Prefilter step died
Error: Search di…
-
synopsis: When running FastK with -k set 32 or less, I'm seeing segfaults.
Specifically, I've seen this with one particular input file (the blue whale assembly) and k in {20,26,31,32}.
Details:
…
-
Command line: /usr/local/bin/spades.py -1 /app/data/R1.fastq -2 /app/data/R2.fastq -o /app/data/output/spades_assembly/read_correction --only-error-correction
System information:
…
-
This was an early design decision on my part to enable richer formatting in the auto generated scripts documentation.
Since we specify the method or attribute name to sphinx-contrib.autoprogram of th…
-
Hi,
I have noticed that kmc tool (latest release) generates wrong k-mers for long (>= 32) reads and short reads (~5) as well.
For example:
AACCACAGATATCTTTAACCAGGATACCATAGAC
the following sh…
-
Hi,
When I run spades for a group of samples I keep on getting the following error mesages
======= SPAdes pipeline started. Log can be found here: /n/scratchlfs/buenrostro_lab/sam_rotation/asse…
-
mmseqs easy-cluster crashes with a very simple file as an input:
```
>UPI0005E38868_574-614
EKVDQNTADITTNTNSINQNTTDIATNTTSINNLSDSITTL
>A0A2T6WYU8_88-128
ENVSQNTADITTNTNSINQNTTDIATNTTNINNLSDSITT…
-
Dear GIAB team,
while doing some k-mer counting using the files indexed at [sequence.index.NA12878_Illumina300X_wgs_09252015](https://github.com/genome-in-a-bottle/giab_data_indexes/blob/master/NA128…
-
Hello,
First of all thank you for making such an amazing program, secondly I was wondering if you could provide some advice on how to handle a very large query database. I have several terabytes th…