-
`cnvkit` output files are missing. There is no segmentation file `.cns` and scatter and diagram plot files `.pdf` in the output folder. They are not generated by `cnvkit batch` module.
-
Hi,
Previously I used this excellent tool to map human rna-seq. Can I use STAR to map coronavirus nucleotide fastq files? If yes, what are general guidelines and where can I find the reference genome…
-
> python /home/arkg/EMIRGE/emirge.py emirge-output/ -1 ../../JdF_1362A_J2.573-2/reads/SSU_reads/JdF1362AcombinedSSU.fastq -f SILVA_132_SSURef_Nr99_tax_silva_trunc.ge1200bp.le2000bp.0.97.fixed.fasta -b…
-
As the deblur require uniform length and usually there is a parameters to trim sequences, I am wondering for the trimming process, whether deblur firstly did a alignment and then trim to the target le…
-
Hi,
For some reason, I keep getting this error when running the process_screen.py. Are these part of the BEAN packages? I am unable to find a way to install them in my system.
**import compressed_…
-
I keep getting an "Error in rule polish_clusters:" using the example data and configuration. Any ideas? The log for the job is shown below. Thanks!
Targets: EGFR_917
Building DAG of jobs...
Using…
belgn updated
3 years ago
-
The analysis of my data is taking too much time.
I run the program for almost 24h and nothing appeared. I started the analysis from a trial of only one round of SELEX and 1 library, that has 2 files…
-
Hello,
I successfully installed vprimer in a virtual environment (I named it env_vprimer) following the manual.
but I encountered error messages while executing the demo scripts.
Below is the m…
-
Good day,
I read your recent paper Zamkovaya et al 2021 in ISME and I am excited to implement a similar network analysis (mdmnets package) with my data, but I am running into issues at the start of …
dvc28 updated
2 years ago
-
Get the following:
```
>Physalia-physalis-Pacific cnidaria_co1 product 0 length 688 kmer count stats mean 53.14 median 54 min 37 max 65
TCATAAAGATATAGGAACATTATACCTAGTCTTTGGTTTATTTTCAGGTATGGTAGG…