-
Hi,
Thanks for the useful tool. Would it be possible to add the option to modify the headers of the output fastq files? I can see in `aligner.py` that the (final) command for generating clean reads…
-
Hi Daniel,
I confess I haven't quite figured out how to customize scoring for each nucleotide character, but I think I'm getting close. As you'll recall from my issue on `triple_accel`, I'm looking…
-
The testsuite crashes on sparc64 with a "Bus error" which is usually an indicator for unaligned access:
```
diamond v2.1.9.163 (C) Max Planck Society for the Advancement of Science, Benjamin Buchf…
-
"Whole-genome sequencing and targeted amplicon capture" says:
> "Do not mark duplicates in the BAM files for samples sequenced by this method"
However, in the BAM file preparation, it is writt…
-
Je trouve Moiki vraiment super mais il manque une tout petite fonctionnalité pour améliorer l'affichage.
Le texte est toujours centré par défaut, et même si ça peut être utile sur petit écran, ça cré…
-
```
What steps will reproduce the problem?
1. Mosaik Build
2. Mosaik Aligner with parameters -hs 15 -act 55 -mmp 0.05 -p 8
3. MosaikSort
4. Mosaik Assembler
What is the expected output? What do yo…
-
>NODE_1_length_151949_cov_17.818703
ACGGATGTCAGTAGCAATAACGGGCATGAAAAGTGACACTGTCACTGATATTCTCAAGGCTGACGAAGCCATTCCAGTAAGCGGCGCATCGCTGGCGACAGGCTGGCGTCATCCTGGTAGCACAGGCACAAACGGCGCTGCGCCCAGCGGTCCTGTAACCCGA…
-
I'm writing a Partial-Order Aligner for DNA sequence, using petgraph as my underlying graph implementation. Currently I'm using chars as my node-weight type so that when I debug things by in Dot forma…
-
Currently in the inversion calling stage of the SV pipeline, it is assumed that insertion and homology around identified breakpoints don't co-exist. But in theory it is possible.
Take an example of a…
-
I haven't been able to get a simple DNA search to produce a result. I am sure I am doing something silly. I couldn't find a simple invocation example for a DNA search in the docs....so:
./parasail…