-
**Is your feature request related to a problem? Please describe.**
There are a few formats that are uses less regularly which we need to develop code to handle
- expanded repeat syntax e.g. c.12_1…
-
Hi,
I'm having trouble running CARMA on TCGA segmented data. The segment files have these columns: Sample Chromosome Start End Num_Probes Segment_Mean
If I run the segment files I have this err…
-
It's useful to have a detailed overview of the new data we have before starting training the models. The data main metafeatures' are described in `/projects/0/einf2380/data/external/processed/I/BA_pMH…
-
Hi,
a TRGT VCF line contains multiple repeat motifs within the same allele, as shown below:
```
chr3 183712187 . CTTTTATTTTATTTTATTTTATTTTATTTTATTTTA CTTTTATTTTATTTTATTTTATTTTATTTTA…
ghost updated
4 months ago
-
Hi Felix,
Thank you for your work on this project. I have a question regarding the different BAM files generated by the SNPsplit, specifically the **allele_flagged.bam** file and the **genome1.bam/…
-
This is such a cool program! I am trying to use it to identify CNVs and paralogs for a salmon species and have run into a couple of strange things. The first is that it seems necessary to conduct filt…
-
Hi,
I am falling within the following error for one of my input GWAS files, and I cannot figure out what may be causing the issue.
if (tokens.Length() == 1) {
printf("## ER…
-
## Overview
While working on the synonym sync, [I noticed](https://github.com/monarch-initiative/mondo-ingest/pull/93#discussion_r1667202320) that this file has no synonyms.
## Additional info
`t…
-
The C++ af-dist implementation added in #157 (and notes in #160) is surprisingly slow. In some informal tests it looks like it's about 3X slower than Python Zarr, just retrieving the chunks. There's …
-
**Is your feature request related to a problem? Please describe.**
Add a link to LitVar to improve the ability to search for variants in literature.
**Describe the solution you'd like**
Add a lin…