-
Hi, thanks for the amazing tool by the way! I'm having an issue where RAxML can't parse alignments for which there are sequences made entirely of undetermined characters:
[e] error while refining…
-
Hello,
I'm trying to run Igor on my T cell receptor beta chain sequences, and everything works great until my sample size is above 100,000 sequences.
I'm getting the following error when using -…
-
Hi,
I'm using MMseqs2 for all-vs-all alignments. As indicated in the user guide pdf, I'm using the bash script to perform a fake prefiltering step before aligning. That seems to work, as all alignm…
-
Split off from #632. Some copied comments follow
@oneillkza says...
> color alignments by secondary/supplementary alignment orientation" The "color alignments by mate orientation" feature is al…
-
-
Hi,
I ran multiple whole genome alignments using cactus to generate the hal file, and ran the "cactus-hal2maf js_hal2maf evolver27species.hal evolver27species.maf.gz --refGenome xxxx --chunkSize 50…
-
Hi Glenn!
I'm currently running `cactus-hal2maf` on a new alignment I've generated using Cactus v2.8.2. I'm running Cactus as a singularity image on a computing cluster. Anyways, I have an alignmen…
-
I'm trying to perform two alignments with AGAThA of sequences about 200bp each. Here are the input files I'm using:
`query_test.fasta`
```
>0
GGATATAGGGGTAGCACTTGATACGGTAGCGGGCTCATTGGAGCATCCGAAT…
quim0 updated
2 months ago
-
Hi,
I successfully run orthofinder using the protein sequences, but I get an error when I run it again using the nucleotide sequences from the same species.
I have DNA sequences for 71 species. Th…
-
I have run just the following commands
mmseqs createdb x_protseqs.fasta x_db
mmseqs cluster x_db x_clust tmp --min-seq-id 0.9
mmseqs createtsv x_db x_db x_clust x_clust.tsv
My input x_protseq…