-
> A lack of tools to precisely control gene expression has limited our ability to evaluate relationships between expression levels and phenotypes. Here, we describe an approach to titrate expression o…
-
Hello,
I'm trying to get guide RNAs out of CasOligo. In Supplemental file Figure S4 several guide RNAs are listed. Is it possible to get the sequence of these guide RNAs from CasOligo? For examp…
-
### Enzyme, ADAR (proof-read and correct mistakes in RNA)
[**ADAR editing enzymes** are found in all multicellular animals and are conserved in sequence and protein organization. The number of ADAR g…
-
I'm following [Bassez](https://carmonalab.github.io/ProjecTILs_CaseStudies/Bassez_BC.html) tutorial. However, during classification step I encounter the following error:
```
> DefaultAssay(ref_cd8…
-
Hello,
I’m trying tor run the analysis on GeoMx data following the guide here: https://bioconductor.org/packages/3.14/workflows/vignettes/GeoMxWorkflows/inst/doc/GeomxTools_RNA-NGS_Analysis.html#
…
-
This issue contains monthly updates to the ranked list of PubMed papers for curation. The full list can be found [here](https://github.com/tanayshah2/bioregistry/blob/5560dcf284f2c0309287e0a5a551e435e…
-
Alex has create a test file containing all human annotations that GO Central want to load:
> The set of protein accessions included in this file is based on UniProt reference proteomes, which provide…
-
The read sequence is `ATGCCCAGGTGCTGAAGCCCC`. Bowtie 2 maps this to the guide RNA reference sequence `ATGAACAGGTTCCGCAGCGG` (all of the reference sequences in this analysis are 20 nucleotides long) an…
-
This issue contains monthly updates to an automatically ranked list of PubMed papers as candidates for curation in the Bioregistry. Papers may be relevant in at least three ways:
(1) as a new prefix…
-
I found this tool after trying to use the function `vmatchPDict` from the Bioconductor package `Biostrings` for barcode matching (which was horribly slow, and took 100 GB of memory if matching with m…