-
There are so many different parameters when I run the flow of ORFS in different circuit, and different setting leads to different resulte. How do you set the parameters in you database in ORFS's confi…
-
Hi again, I wanted to check if there was an easy way to do this with ORFik before writing something...
Let's say I am searching for ORFs in novel transcripts, but my novel transcript encodes a know…
-
Not sure if this is a bug or if I am missing a flag that would make this all work as expected.
## Expected Behavior
I wish to taxonomically annotate contigs using the `mmseqs easy-taxonomy` workfl…
-
Hi,
Thank you for your tool. I am currently using FeGenie on contigs and have tried to use it on ORFs as well. My results are quite different and those for ORFs are incoherent. I have the impressi…
-
HI!
I've noticed that when you have an ORF that can't be annotated with any of the databases currently in set, pLannotate does not produce an CDS feature. Adding a custom database via the `-y` optio…
-
Hello,
I've implemented function for plotting potential ORFs in 6-frame translation as ascii string.
It looks like this.
```
print(ascii_frameplot('ACATGTCAGTCGTGTGATCGTGTACGTCGATGATC', table=1…
-
Dear authors,
I'm a bit confused with the different taxonomy abundances calculated by SqueezeMeta : for instance when using : "genus_tax=Hadza$taxa$genus$abund", do you get the sum of abundances in…
-
After https://github.com/camilogarciabotero/GeneFinder.jl/pull/26 and https://github.com/camilogarciabotero/GeneFinder.jl/pull/32 we can now have a more flexible way to use the `findorfs` with multipl…
-
I was wondering why Ribotricer does not have an ORF category that is called "internal". I was trying to compare results for ribotricer and ribocode and I identify an internal ORF in RiboCode that does…
-
Hello all!
I would like to report a issue in the first step of VirClust analysis. The first step (step1A) is the orf prediction and we have obtained an error issue for this step with a multifasta fi…