search

Kukuster / SumStatsRehab

GWAS summary statistics files QC tool
https://doi.org/10.1186/s12859-022-04920-7
MIT License
33 stars 6 forks source link
bioinformatics bioinformatics-tool compbio computational-biology data-prep data-preparation data-preprocessing gwas gwas-pipeline gwas-summary-statistics summary-statistics sumstats

readme

SumStatsRehab

SumStatsRehab is a universal GWAS SumStats pre-processing tool. SumStatsRehab takes care of each of the original data points to maximize statistical power of downstream calculations. Currently, the only supported processing which may result in a loss of the original data is liftover, which is a common task, and is optional to the user.

Examples of what the tool does:

Example of what the tool does not:

SumStatsRehab aims to be a production-grade software, but you may find it to be not a complete data preparation solution for sumstats-ingesting pipelines. Yet, the tool streamlines the development of the data preparation part. This comes out from focusing on solving more complex problems that span many different use-cases, instead of covering only specific use-cases.

dependencies:

Installation and basics

  1. clone this repo

    git clone https://github.com/Kukuster/SumStatsRehab.git && cd SumStatsRehab

  2. install requirements

    pip install -r requirements.txt

  3. install SumStatsRehab as a package

    python3 setup.py build
python3 setup.py install

  4. run the command using the following syntax:

    SumStatsRehab <command> [keys]

Use diagnose to check the validity of entries in the GWAS SS file.

Use fix to restore missing/invalid data in the GWAS SS file.

Use prepare_dbSNPs to preprocess a given dbSNP dataset into 2 datasets, which are used in the fix command.

Use sort to format the input GWAS SS file and sort either by Chr and BP or by rsID.

To use the fix command to its fullest, a user needs:

Deprecated installation method (since March 15, 2022):

pip install git+https://github.com/Kukuster/SumStatsRehab.git

or, for specific version:

pip install git+https://github.com/Kukuster/SumStatsRehab.git@v1.2.0 --upgrade

This installation method doesn't work with the currently upcoming git protocol security update on github:

Tutorial

1. Download dbSNP dataset

Download dbSNP datasets from NCBI, in the target build, in vcf, vcf.gz, bcf, or bcf.gz format. The latest versions are recommended. dbSNP datasets are used to restore the following data: Chr, BP, rsID, OA, EA, EAF. Although only builds 37 and 38 are explicitly supported, build 36 may work as well.

For example, curently latest datasets for build 38 and build 37 can be downloaded here:

https://ftp.ncbi.nih.gov/snp/latest_release/VCF/

2. Download the chain file

A chain file is necessary to perform liftover. If a GWAS SS file is provided in the target build, then a chain file is not used.

3. Preprocess dbSNPs datasets

3.1 Download and install bcftools and gz-sort

see instructions on their websites and/or githubs

recommended bcftools version: 1.11

NOTE: after preprocessing of the necessary dbSNPs is finished, these tools are no longer needed

3.2 Run preprocessing

Run prepare_dbSNPs using the following syntax:

SumStatsRehab prepare_dbSNPs --dbsnp DBSNP --OUTPUT OUTPUT --gz-sort GZ_SORT --bcftools BCFTOOLS
                                  [--buffer BUFFER]

where:

Depending on the size of the dataset, specified buffer size, and specs of the machine, preprocessing may take somewhere from 30 minutes to 6 hours.

After preprocessing, steps 4 and 5 may be repeated ad-lib.

4. Create a config file for your GWAS SS file

Config file is used as meta data for GWAS SS file, and contains: 1) columns' indices (indices start from 0) 2) input build slug (such as "GRCh38", "GRCh37", "hg18", "hg19")

This config file has to have the same file name as the GWAS SS file but with an additional .json extension.

For example, if your GWAS SS file is named WojcikG_PMID_htn.gz, and the first 5 lines in the unpacked file are:

Chr     Position_hg19   SNP     Other-allele    Effect-allele   Effect-allele-frequency Sample-size     Effect-allele-frequency-cases   Sample-size-cases       Beta    SE      P-val    INFO-score      rsid
1       10539   1:10539:C:A     C       A       0.004378065     49141   0.003603676     27123   -0.1041663      0.1686092       0.5367087       0.46    rs537182016
1       10616   rs376342519:10616:CCGCCGTTGCAAAGGCGCGCCG:C      CCGCCGTTGCAAAGGCGCGCCG  C       0.9916342       49141   0.9901789       27123   -0.1738814      0.109543        0.1124369        0.604   rs376342519
1       10642   1:10642:G:A     G       A       0.006042409     49141   0.007277901     27123   0.1794246       0.1482529       0.226179        0.441   rs558604819
1       11008   1:11008:C:G     C       G       0.1054568       49141   0.1042446       27123   -0.007140072    0.03613677      0.84337 0.5     rs575272151

your config file should have the name WojcikG_PMID_htn.gz.json and the following contents:

{
    "Chr": 0,
    "BP": 1,
    "rsID": 13,
    "OA": 3,
    "EA": 4,
    "EAF": 5,
    "beta": 9,
    "SE": 10,
    "pval": 11,
    "INFO": 12,
    "N": 6,

    "build": "grch37"
}

Notes:

5. Run the fix command

When the config file is created, and dbSNP datasets are preprocessed, the chain file is downloaded if necessary, then the fix command can use all its features.

Although it is normally a part of the execution of the fix command, a user may choose to manually run diagnose beforehand.

If diagnose is ran without additional arguments, it is "read-only", i.e. doesn't write into the file system.

Run diagnose as follows:

SumStatsRehab diagnose --INPUT INPUT_GWAS_FILE

where INPUT_GWAS_FILE is the path to the GWAS SS file with the corresponding config file at *.json

as a result, it will generate the main plot: stacked histogram plot, and an additional bar chart plot for each of the bins in the stacked histogram plot.

These plots will pop up in a new matplotlib window.

The stacked histogram maps the number of invalid SNPs against p-value, allowing assessment of the distribution of invalid SNPs by significance. On the histogram, valid SNPs are shown as blue, and SNPs that have issues are shown as red. The height of the red plot over each bin with the red caption represents the proportion of invalid SNPs in the corresponding bin.

WojcikG_PMID_htn gz

A bar chart is generated for each bin of the stacked histogram plot and reports the number of issues that invalidate the SNP entries in a particular bin.

bin_3__1e-5—1e-3

If a Linux system runs without GUI, the report should be saved on the file system. For this, run the command as follows:

SumStatsRehab diagnose --INPUT INPUT_GWAS_FILE --REPORT-DIR REPORT_DIR

where REPORT_DIR is an existing or not existing directory under which the generated report will be contained. When saved onto a disk, the report also includes a small table with exact numbers of invalid fields and other issues in the GWAS SS file.

Finally, a user may want to decide to run the fix command.

A user should run the fix command as follows:

SumStatsRehab fix --INPUT INPUT_GWAS_FILE --OUTPUT OUTPUT_FILE
                       [--dbsnp-1 DBSNP1_FILE] [--dbsnp-2 DBSNP2_FILE]
                       [--chain-file CHAIN_FILE]
                       [--freq-db FREQ_DATABASE_SLUG]
                       [{--restore,--do-not-restore} {ChrBP,rsID,OA,EA,EAF,beta,SE,pval}+]

where:

example:

SumStatsRehab fix --INPUT "29559693.tsv" --OUTPUT "SumStatsRehab_fixed/29559693" --dbsnp-1 "dbSNP_155_b38.1.tsv.gz" --dbsnp-2 "dbSNP_155_b38.2.tsv.gz" --chain-file "hg19_to_hg38.chain" --freq-db TOPMED --do-not-restore OA EA

As the normal process of fix, a report will be generated for the input file, as well as for the file after each step of processing. Depending on the availability of invalid/missing data in the GWAS SS file and the input arguments, a different number of steps may be required for a complete run of the fix command, with 1 or 2 loops performed on the GWAS SS file. All steps are performed automatically without prompt. The process of fixing is represented in logging to the standard output and may take anywhere from 5 minutes to 1.5 hours, depending on the size of the file and the number of steps.

As a result, if 1 loop was required to fix the file, then the resulting file will be available with the suffix .rehabed.tsv. If 2 loops were required, then the resulting file is available with the suffix .rehabed-twice.tsv.

The report made with a diagnose command will be available in a separate directory for:

Manual

Please refer to the instructions by running

SumStatsRehab -h

or

SumStatsRehab <command> -h

NOTES

config file

Config file is a json object which supports the following properties:

And

It is also possible to set EAF to a weighted average of multiple colums. E.g. if there are separate freq. columns for case and control groups, and average freq. is needed, number of participants in each group will serve as weights for the two columns:

{
    ...
    "EAF": {
        "4": 1001,
        "5": 2500
    },
    ...
}

During the fix command, the input sumstats file may undergo sorting. If you want any other columns to be included in the resulting fixed file, add 0-indexed column indices in an array as the "other" parameter in the config.

E.g.:

{
    ...
    "other": [7, 8, 2],
    ...
}

With this entry, the resulting file will have 3 additional columns at the end in the order as their indices appear in this config entry.

"standard" format

Commands fix and sort always output files in this format. Internally, input files are always converted before undergoing any processing. lib/prepare_GWASSS_columns.py is responsible for formatting the input.

Supplementary Information

The two key functions of SumStatsRehab are validation and restoration, implemented for 9 data categories: chromosome, base pair position, rsID, effect allele, other allele, allele frequency, standard error, beta, p-value. Each column is validated independently of the others, and is regarded to have two possible states: valid and invalid. With the exception of the case where only one of either the chromosome or base pair position is a valid entry, valid entries are always kept and invalid entries are subject to restoration.

  1. Value in the chromosome field is considered to be valid if and only if it includes one of the following values: '1', '01', '2', '02', '3', '03', '4', '04', '5', '05', '6', '06', '7', '07', '8', '08', '9', '09','10', '11', '12', '13', '14', '15', '16', '17', '18', '19', '20', '21', '22', '23', 'X', 'x', 'Y', 'y', 'M', 'm'. In practice, ‘chr1’, ‘chr01’, ‘Chr1’,‘Chr01’, ‘1’, and ‘01’ are all similarly recognized as referring to chromosome 1. Any entries which do not include a specific chromosome number reference are subject to restoration.
  2. Base pair position entry is considered to be valid if and only if it is a non-negative integer.
  3. rsID entry is considered valid if and only if it is an arbitrary integer value with ‘rs’ prefix.
  4. Effect allele and other allele entries are considered to be valid if and only if the value is either a dash (representing a deleted allele), or any non-empty combination of letters A, T, C, and G.
  5. Any floating-point value between 0 and 1 inclusively is considered to be a valid allele frequency entry and p-value entry.
  6. Any floating-point value is considered to be valid standard error entry and beta entry.

While most of the columns are assessed independently, the restoration process often involves multiple columns.

  1. Chromosome and base pair position entries are only restored together for any particular row. If any of the two values are invalid or missing, and rsID entry in the row is present and valid, then the two columns are subject to restoration. This is the only case where a single potentially valid entry can be rewritten or removed as a result of restoration. Chromosome and base pair position entries are restored by a lookup in the preprocessed DB2 for a matching rsID entry. If a match wasn’t found, both chromosome and base pair position entries are replaced with a dot ‘.’, representing a missing value.
  2. Similar to the current implementation of MungeSumstats, SumStatsRehab restores rsID entry by chromosome and base pair position. If rsID entry is missing or invalid, but both chromosome and base pair position are valid, then SumStatsRehab attempts to restore rsID by a lookup in the preprocessed DB1 for matching chromosome and base pair position entries. If a match wasn’t found, rsID is set to a dot ‘.’ This requires chromosome and base pair position entries in the row to be present and valid.
  3. EA and OA entries are restored in the same way. If one of the two alleles is invalid or missing and the other one is present, and either rsID or both chromosome and base pair position are valid, then the missing allele can be restored. First, if rsID is present, then the missing allele is restored by a lookup in the preprocessed DB2 for matching rsID entry and the present allele. When rsID is not present, but Chr and BP are present, then the missing allele is restored by a lookup in the preprocessed DB1 for matching Chr and BP entries and the present allele. Otherwise, or if a lookup fails, then no entries are rewritten.
  4. Allele frequency is restored as the effect allele frequency, and it’s done in a similar way: first by a lookup in DB1 for matching rsID and EA, if rsID is present; second by a lookup into DB2 for matching Chr and BP and EA. Restoring allele frequency requires frequency entries in the INFO field in the SNPs dataset that was preprocessed. By default, frequencies are taken from the database of Genotypes and Phenotypes (dbGaP), but an alternative database contained in the dbSNP dataset may be used as an argument in the FIX command.
  5. Each of the columns, standard error, beta, and p-value, are restored from the other two, using the following relation: s = β/z, where s is the standard error, β is beta, and z is z-score that corresponds to the p-value in the two-tailed test (Zhu et al. 2016). If standard error is signed, then beta can be restored accurately, but if standard error is provided as an absolute value, the restored beta will be correct only as an absolute value, with an unknown sign. Files restored in this manner will have little utility in downstream applications, but may be useful in comparing relative effect sizes.

Warning: Restored betas with an unknown sign should not be utilized in any downstream application.

BACKLOG