-
Hi,
I use abPOA to produce multiple consensus sequence, three most frequency sequences are
> 1 with a depth 25
CCCTCCCTTCCTTTCTTTCTCTCTTTCTCCCTCTCTTTCTCTTTCATTTTTCCTC
> 2 with a depth 40
CCCTTC…
-
Dear Developers,
Installation command: mamba create -n piranha -c bioconda piranha-polio=1.3 -y
It look like the same problem as "https://github.com/polio-nanopore/piranha/issues/242"
The probl…
-
Hi,
I tried to run TEtrimmer with the test set, using the command:
**TEtrimmer --input_file test_input.fa --genome_file test_genome.fasta --output_dir test_output --num_threads 20 --classify_all…
-
Dear Developers,
Installation command: mamba create -n piranha -c bioconda piranha-polio=1.2.1 -y
Installation command: mamba create -n piranha-V2.5 -c bioconda piranha-polio=1.2.5 -y
The install…
-
First of all, amazing work! I've been hoping for something like this for quite some time!
It seems like users upload consensus sequences, which is standard at the moment, but is there any interest …
-
We're having a trouble with the bash script to for generating consensus sequences. It runs without errors, and generates a file for each locus, but each of those files is blank.
Does anyone hav…
-
Hello,
I would like to ask if the consensus sequences of delly's output are human or just unknown insertion sequences (maybe virus or bacteria ones).
Thank you.
-
Dear,
I'm running nextclade when analysing RSV, but I want to change reference, so I run
```
nextclade-x86_64-unknown-linux-gnu run \
-r ../data/general_data/ref/reference_seq.fasta \
-m ../d…
-
Hello Trust4 Team,
Thank you for developing such a useful tool.
I’ve encountered an issue and don’t know how to deal with it.
I have 8 bulk RNA-seq samples, and their FASTQ files are approximate…
-
I'm interested in developing consensus COI reference sequences for major groups in BOLD:
[BOLD](https://www.boldsystems.org/index.php/TaxBrowser_Home)
I'm guessing I can parse the database infor…