-
Task Description:
- Classifier, NER & QA encoder model update
- QA vs NER based extraction comparison
- Pretrained and on the spot training model options
-
### The problem
To get the camera to work in this board you need:
https://github.com/Freenove/Freenove_ESP32_S3_WROOM_Board
![Freenove_ESP32_S3_WROOM](https://github.com/Freenove/Freenove_ESP…
-
**Is your feature request related to a problem? Please describe.**
At the moment there are many validation-samples used in verifying the quality of the new releases of balsamic, however the list of…
-
Hi.
I found a certain variant from our sample and concluded it was originated from other species which was called using VarDict.
`chr19 33302104 CCGCCGCCGCCGCCGCCCGTGGGGCCCA TTGCCGCCTCCTGCGGGGGC…
tahuh updated
4 years ago
-
One major theme raised in #234 is the question of "how do we handle Allele normalization when the Allele Location is specified by Ranges"? To me, these have always seemed to be a shorthand for "I did …
-
Hello,
I am trying to use gatk/4.1.4.1 and picard/2.22.0 to do joint variant calling of PacBio HiFi reads and Illumina short-reads.
My pipeline is basically the recommended one (without base reca…
-
Here are some suggestions for improving the filtering ui:
- [ ] Sliders as input for numeric inputs: frequency filtering, CADD scores and (not implemented) SV size for example
- [ ] Reduce size of Ge…
-
Hello,
In large cohorts (~100K) multi-allelic sites are very common. Furthermore, good rare alleles can share the locus of bad, "common" variants (they are common since they seem to appear in many in…
-
### Description of bug
![image](https://github.com/MultiQC/MultiQC/assets/41360525/7e1df32e-301a-419d-ae11-43e0a3977153)
Violin plot:
![image](https://github.com/MultiQC/MultiQC/assets/41360525/e…
-
Hi, strelka team
I was really impressed by the model and performance of strelka in calling somatic mutations. But I have a question on the variant form in the vcf file. Can strelka report MNPs, com…