-
The vignette recommends the usage of Bowtie 2 to map gRNAs to the library sequences. However, there are a number of issues on Bowtie 2's [tracker](https://github.com/BenLangmead/bowtie2/issues) highli…
-
On line 168 and 169, the two sequence constraints should be created for "gRNA_b_gene", not for "cas9m_BFP_gene".
-
Deepak: Could you please look into it in case there is any problem.
20150626 email:
Ye Chu (ye.chu.test@gmail.com) sent a message using the contact form at
http://www.peanutbase.org/contact.
I was t…
-
In oder to distinguish the interactor that have a
sequence (nucleic acid and protein) from those who do
not (small molecules, complexes) we propose to add the
term "polymer" in the PSI interactor type…
-
In oder to distinguish the interactor that have a
sequence (nucleic acid and protein) from those who do
not (small molecules, complexes) we propose to add the
term "polymer" in the PSI interactor type…
-
First, I want to say thanks for your Perl script of searching gRNA, and I just have a little question that really need your help. I want to assign my own genome data through 'db' => 'genome' in…
-
To reproduce, use Fasta file:
> s1
> GGCCGACCTGTCGCTGACGCAGG
Use input file:
NNNNNNNNNNNNNNNNNNNNNNN
GGCCGACCTGTCGCTGACGCAGG 5
Get a segmentation fault. However, if we use Fasta file, it works.
>…
-
Please add:
name: siRNA processing
definition: Any process involved in the conversion of a
primary small interfering RNA transcript into a mature
small interfering RNA molecule.
reference: TAIR:tb
pa…
-
**Reported by eilbeck on 2008-10-28 21:14 UTC**
Hello everybody,
I am considering using the OBO ontology synonyms as a dictionary for
text mining. However, since the SO uses underscores for the main …
-
Annan sortering av ranking vid lika poäng. Nu sker sortering efter alfabetisk ordning. Vid lika poäng bör den som spelade senast placeras högre upp.
jj71 updated
12 years ago