-
Hello
I wanted to try out RawHash on some human genome data. I am still at the first step on generating the index.
For R9.4 I could create the index using the following command without any issue.
…
-
I using the latest kmc code but i can't count kmer on fastq file. It work on fasta
```
$cat r1_test.fq
@0|Chromosome|4051100|4051286/2 BX:Z:CGACACGGTTTGGGCC
AAACCCAACCAC
+
FFFFFFFFFFFF
$kmc …
-
Hello,
I am wondering about the difference between `eventalign` and `resquiggle`.
As I understand it from https://hasindu2008.github.io/f5c/docs/output,
`resquiggle` aligns a nucleotide sequence…
-
Dear author
I don't see the files needed to generate the drawing in the code you provided, as follows
![image](https://user-images.githubusercontent.com/58722433/224951947-78d8e3ec-e036-46d6-b8b3-…
-
Hi,
A good job of rewriting of meryl. We found some issues of it in our tests too.
Is it OK to add kmer-mask support too? firstly it is OK to just add the support of the make of kmer-mask sourc…
-
Hi,
It suggests that flappie has separate models (r941_native and r941mC_native) for R9.4 MinION and PromethION flow cell. Can you please let me know if there is a way to extract the kmer model fro…
-
I have created u64 representations of a kmer like this:
```
for kmer in needletail::kmer::Kmers::new(seq, 32 as u8 ) {
let km = Kmer::from(kmer).into_u64();
```
Is there a function to revers…
-
I have a few clarifying questions about the kmer/minimizer stuff because it keeps tripping me up. Correct me if I am wrong, but how I picture the kmer/window size thing working is that a reference gen…
-
Hi,
I have noticed that kmc tool (latest release) generates wrong k-mers for long (>= 32) reads and short reads (~5) as well.
For example:
AACCACAGATATCTTTAACCAGGATACCATAGAC
the following sh…
-
Dear cuttlefish authors,
Thank you for this useful tool. I have a large database of genomes and I want to reduce the redundancy to reduce the computational time, improve speed and reduce RAM usage …