-
Hey
I am trying to run the whole pipeline for crop-seq, i am at the assign_gRNA_cells.py step and it is giving error.
File "assign_gRNA_cells.py", line 359, in
prj.add_sample_sheet()
Fil…
-
Hi,
I am trying to design gRNA to revert a SNP.
I realized that the designed gRNA has the wild-type allele of the SNP. I guess that this mismatch will not affect the gRNA binding to the target locus…
-
Hi,
I am trying to design a gRNA for base editor SA(KKH)-BE3 (pam:NNNRRT).
The sequence flanking my SNP ( bold C) from file 01_sequences/dbedntmuts.fa is GAAATGTTTGAGGATGACTCCT**C**GCAGCCTGGTCCC…
-
Hello Luca,
Is there any way to have longer allele sequences in the file Alleles_frequency_table_around_cut_site_for_*.txt?
It would be useful for the analysis of HDR events that are located far…
-
Hi Aaron,
I am running into a error while testing FlashFry to look for gRNA in my dataset. I have 12 sequences(100bp/each), use hg38 assembly. I was able to get the "discover" function to work (out…
-
Consider adding the following to the report:
- [completed] karyogram like figure to show genomic distribution of target sites (on/off)
- [completed] Compare probable off-target sites against ran…
-
# SEP V004: New Glyph Collection
| SEP | |
| --- | --- |
| **Authors** | Jacob Beal (jakebeal@ieee.org) |
| **Editor** | |
| **Type** | Specification |
| **SBOL Visual Version** | 1.1 |
| *…
-
The CRISPOR website provides warnings of potential problems with gRNA sequences, such as presence of TTTT that terminates transcription from U6 promoters, but I do not see these warnings in the output…
genya updated
5 years ago
-
I'm wondering how we're supposed to encode epigenetic information for passing into the "off-target" version of the pipeline. The model wants both the sgRNA and the target as 8-channel vectors that inc…
-
Hey, great software. I'm currently trying to annotate a genome with gRNA sequences and I want to make it a track UCSC browser. Can you give me a bit of instruction on how to use bedannotator to prefor…