-
Once again, I have no idea how to reproduce this, I just know that nothing becomes actually entombed and it crashes with the mods, and not without the mods.
## Mod Versions
Latest versions from st…
-
### What is the expected behavior?
Let's add randomized benchmarking from Ignis as one of the benchmarks under `test/benchmarks`. It is helpful for tracking performance.
-
**Please provide the following information**
### qBittorrent version and Operating System
4.0.3 - Windows 10
### What is the problem
When manually adding trackers to torrent (bulk add, several…
-
Hi,
I am trying to align a query NT sequence against a ref AA sequence using blastx.
query sequence:
AGGGCCTACCTGGAGGGCACGTGCGTGGAGAGGCTCGCAGACACCTGGAGAACGGGAAGGAGACGCTGCAGCTCACGGGT
ref sequ…
-
-
Dear MMseqs2 team,
I got some wired results which I could not explain by myself. I hope you can help me with it.
## Expected Behavior
I was expecting MMseqs2 to be more sensitive if using defau…
-
I cloned pfsspy from the github landing page (master branch) and found the dtime keyword appears to be missing from the Input class __init__() function . Seems an older version of it may have propagat…
-
## Use cases
- An agricultural robot that plows, seeds, etc. by going back and forth on a given area.
- A patrolling robot that covers the perimeter of some area. The perimeter to cover (waypoints…
-
Variables `dFPR`, `nEntry`, and `tEntry` in various header files might not be needed. We should remove them and make sure the readme reflects the changes.
-
I'm running into a core dump error while running biobloommicategorizer (v2.3.2). I'm creating a mask like so:
```
biobloommimaker -p reads cosmic_transcripts.fasta -g 56 -t 8
```
Then running …