-
- [ ] determine what the fields in the trial-level mean, which ones to keep, how to document/rename them
- [ ] write a script to create a dataframe from a single FishFlanker file. apply to all existin…
-
Hello,
https://flanker.readthedocs.io/en/latest/
-
I am having difficulty understanding some of the information in the documentation. In order to fully understand and reproduce the information…
-
Since most games allow Flanking, will MookAI prioritize placement where it would flank the PCs, by checking if there;s another hostile NPC on the opposite side.
-
As title says, the positional feedback doesn't seem to be working for ninjas specifically. Regardless of angle, both it's rear and flank register as failed
-
Hi,
I am using the PolyA tail estimation in plasmids and I get shorter lengths than expected. I have a few questions about how to set up this feature.
The plasmid I sequenced has a very long poly…
-
## Overview
As we have introduced test bundling, we want to use its capabilities such as test sharding.
While updating our CI workflow with Firebase Test Lab, I have tried to run sharded tests wit…
-
Hi I'm trying to implement custom sharding on iOS. Without a custom sharding json file, i'm able to run tests using github actions. However with custom sharding the name of the xctestrun file changes …
-
**Describe the feature you'd like**
When Vicewinder is pressed, I'd like for Twinfang to only replace the "left" or "flank" abilities when requirements for execution are met, while Twinblood only rep…
-
Can I know when flames match flanking sequence `CTACACGACGCTCTTCCGATCT,` do they allow matching with an edit distance or it has to be exact match?
-
A question that will become important when we add flanking site automation: is there any way to distinguish between a part that already has a flanking site vs. a part that has an illegal cut site that…