-
Dear developers:
openDBA has many applications, which are very interesting. Nanopore provides a kmer model for generating standard nanopore signals. By providing a sequence based on this kmer model, …
-
Hello, I needed a matrix of the kmer counts for several samples. I followed the instructions given in the [example](https://github.com/tlemane/kmtricks/wiki/Count-matrix-example) of the documentation,…
-
Using the glistmaker, I managed to create a .list file using a fasta file for the HG38 reference genome. While I am able to make .db files using this .list file, and while said .db files say they are …
-
Hi Team,
Just wonder whether open syncmer could be another option (https://github.com/bluenote-1577/local-kmer-selection-results/blob/db4c5c686433fb09f8571da7ca11b355aaa28e30/src/seeding_methods.rs…
-
Hi,
I am trying to use the SubPhaser to phase the subgenomes of my species. However, after filtering differential kmers, no differential kmers were remained. I used parameter of this `-k 15 -q 50 -…
-
Thank you for developing this pipeline.
I've noticed that for my allotetraploid species, while -k 15, -k 14 works fine, once I try -k 13 or -k 12, there are a lot of broken pipeline issues. A lot …
-
Get the following:
```
>Physalia-physalis-Pacific cnidaria_co1 product 0 length 688 kmer count stats mean 53.14 median 54 min 37 max 65
TCATAAAGATATAGGAACATTATACCTAGTCTTTGGTTTATTTTCAGGTATGGTAGG…
-
Hi,
I am using `canu-v2.2` to assemble a plant genome using the following command on SGE system.
```
canu -p CANU_NG -d CANU_NG genomeSize=3.5g -nanopore ONT.genome.fastq.gz
```
It is always …
-
Hi, is kMermaid currently active? When I try to download the model I get a txt file.
-
The following functionality needs to be added:
- [ ] Standardize naming scheme and file form for resistance kmer "db" file
- [ ] New section to configuration file for resistance kmer file
- [ ] U…
ar0ch updated
4 years ago