-
The documentation is poor and unclear about how to use this pipeline. Does this pipeline require installation? Can you show some example code?
My suggestion is to follow some good practice, e.g., …
-
**Describe the bug**
A clear and concise description of what the bug is.
Alignment issue - main concern here is probably the amplicon sequence (is it the sgRNA sequence (a.k.a the recognition sequen…
-
I'm wondering how we're supposed to encode epigenetic information for passing into the "off-target" version of the pipeline. The model wants both the sgRNA and the target as 8-channel vectors that inc…
-
the user does not understand why one can select a cell line.
I would do a radio select for design sgRNA against hg19 or cell line specific (but I am not sure whether you actually do that or whether i…
-
The input file is supposed to be like this:
row1: GENE_CLONE GENE Sample1 Sample2
row2: A1BG_CACCTTCGAGCTGCTGCGCG A1BG 94 713
But screens data are now analyzed with TKOv2 that contains the genom…
-
Would it be possible to make the setup quicker, by adding a set of radio buttons to the **Upload Your sgRNA Library File** in the screen setup section ? That would remove the need for users to downloa…
-
Thanks for the software and the recent addition of allowing outies for flash ! TOP :+1:
Would you maybe as well considering following change as well in the Core code?
```python
…
-
Several users ask me to help on identifying the detail of off-target events for the sgRNA designed by sgRNA Designer (http://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design-v1). I wi…
-
The vignette recommends the usage of Bowtie 2 to map gRNAs to the library sequences. However, there are a number of issues on Bowtie 2's [tracker](https://github.com/BenLangmead/bowtie2/issues) highli…
-
While analyzing the results of the growth screens #11, I noticed some weird behavior by the "decreasing" genes. These are the genes are that are expected to fall out of the experiment as you increase …