-
I could not run the sortmerna on my computer, because it does not have enough RAM(my computer has 20G RAM )
ERROR is: Segmentation fault (core dumped).
And I will list the code at the end.
…
-
Hi There,
I ran Pychopper after Dorado SUP basecaller v0.7.2 in a Linux server.
I used a command similar to:
```
pychopper -r ${SAMPLEID}_report.pdf \
-k LSK114 \
-S ${SAMPLEID}_stats.tsv \…
-
Hi,
I'm encountering an issue while mapping some samples using STAR. The process begins normally and successfully maps the first sample, but then the subsequent samples are ignored. When I attempt to…
-
Hello!
I run:
**reckoner -genome 4500000000 -prefix ${p} -threads 128 -kmcmemory 900 -longkmer -verbose -reuse ${r1} ${r2}** …
-
Hi,
I am trying the two methods: phmm and edlib. I found phmm has a high reproducibility, giving the same result between different runs. While edlib can give very different results. I am wondering …
-
The r2 reads is specified with GTGAGTGATGGTTGAGGTAGTGTGGAG at 5'. So I use `--adapter_sequence_r2 GTGAGTGATGGTTGAGGTAGTGTGGAG` to identify the valid reads, and the command is shown below:
```
fast…
-
Hi, I noticed some strange behavior when running HISAT2 (v 2.1.0) on many files at once. Some background: The data I'm working with are from 2 flow cells (fcA/B), 4 lanes each(L001/2/3/4), paired end,…
-
### Description of the bug
Need to remove “.fq.gz” from docs.
Files not picked up by seqtk.
### Command used and terminal output
```console
nextflow run nf-core/demo -profile singularity --input…
-
Hello,
trim_galore -o output --fastqc --paired $R1_file $R2_file
I have utilized trim-galore to trim illumina adapters on my PE sequencing reads.
When I tried to process the output fq files t…
-
When processing multiplexed files, the following temporary files are created in `/` (where `` is the name of a multiplexed file (without path or extension) defined in `multiplex_fq_files`):
```
_t…