-
We have a two sets `[A x B]` and `[C x D]` of F0 animals which were short read sequenced. The F0 ([A x B] and [C x D] )were repeatedly mated to give `F1` `[AB]` and `[CD]`. The F1 were then mated to…
-
Hello, I have encounter a new issue when running the scRNA-sequencing. And the error message is below. At first I thought it was due to the pandas package so I updated my pandas to the latest version…
yc508 updated
10 months ago
-
@scheibelp -- Follow up to https://github.com/spack/spack/pull/12940
Some of the packages (at least one, but I'm trying to figure out which) point to a private GitHub repo which causes a the comman…
-
For purposes of anonymization I need to rename the cell-names which include the study number in our dataset.
I have a Seurat-object with `test@assays$RNA$counts@Dimnames[2])` and `test@assays$SCT$…
-
-
Hi, I found the download link in the tutorial does not work:
![image](https://github.com/QuKunLab/SpatialBenchmarking/assets/43333475/95735034-e430-4284-890b-240c9ffba558)
Could you please updat…
-
Dear developers,
I have tried JunctionSeq in my project (RNA-Seq-based analysis of alternative splicing during plants development ). JunctionSeq is really a useful tool with powerful visualisation …
-
While running the COMPSRA example workflow with the following command `java -jar COMPSRA.jar -ref hg38 -qc -ra TGGAATTCTCGGGTGCCAAGG -rb 4 -rh 20 -rt 20 -rr 20 -rlh 8,17 -aln -mt star -ann -ac 1,2,3,4…
-
Hello,
I was happily using `clustree` package for a while.
However, I received an error message when I run this code;
`clustree(x = my_data,prefix = "RNA_snn_res.",exprs = "data",assay = "RNA")`
…
-
Recent versions of STAR can merge overlapping pairs of reads into a single read for alignment. One drawback is that it makes it hard to calculate insert size with existing quality control tools which …