-
As far as I understand it from your paper, BigMHC supports predictions for all human class I alleles. However, it doesn't restrict the input provided to the -a option to only human class I HLA alleles…
-
Hi,
I am new to using bcftools +liftover, I want to liftOver from hg38 to hg19.
However, I get the error:
"Error: the reference allele GT does not match the reference NN at..."
I converted my …
ktg25 updated
2 weeks ago
-
Hi,
I use abPOA to produce multiple consensus sequence, three most frequency sequences are
> 1 with a depth 25
CCCTCCCTTCCTTTCTTTCTCTCTTTCTCCCTCTCTTTCTCTTTCATTTTTCCTC
> 2 with a depth 40
CCCTTC…
-
Hi Zachary,
What is your recommendation on minor allele filtering before running saltiLassi? I'm thinking to filter maf
-
Hi @freeseek ,
What does 0 and 1 represent for ALLELE_A and ALLELE_B in the VCF INFO?
It seems like the Picard tools GtcToVcf implementation write alleles themselves in the Allele A and Alllele…
-
**1. What were you trying to do?**
Run `vg call` to genotype sample
**2. What did you want to happen?**
Output a valid VCF
**3. What actually happened?**
The alternative allele is m…
-
We need to implement the "local alleles" approach to deal with overblown PL fields.
See discussion: https://github.com/sgkit-dev/vcf-zarr-publication/issues/5
-
Hello,
May I ask why allele list DRB is single but DPA/DPB or DQA/DQB are in pair? And if there is any option to input only DPB instead of the pair type for prediction?
Thank you very much
-
The tabular output can be used for automated allele designation update, but having the common name in the same field prevents this.
-
Hello,
I am looking to see if there's a way to adjust the variant allele frequencies (VAF) in mosaic mode to detect below 5%?