-
By comparing FR4Begin of human TRBJ2-7*01 and TRBJ2-7*02, TRJBJ2-7*02 should be changed from 20 to 19. As a consequence, mixCR will produce a consensus VDJ sequence missing the bp "G" and wrong FR4 tr…
-
For better sequencing quality, I add stagger in my PCR primers just like "N{2:4}{PRIMER}". And my protocol also integrates the UMI tag into the DNA library.
So after `align` and `refineTagsAndSort…
-
Hi,
Thank you for good tool!
I am using Platypus v3.4.1 in windows PC to analyze BCR repertoire.
I've followed the PlatypusV3 vignette and have been able to Extracting and integrating repertoire…
-
Hi,
I am quite new in the BCR/TCRsequencing field and I wanted to try to compare TRUST4 and MIXCR on a simple dataset (amplicons of the CDR3 regions).
I have a paired end fastq with about 20'000 r…
-
## 🚀 Feature
Most BCR analysis programs (ex. MIXCR and IMMCANTATION) also output a field with information regarding the constant chain (ex. IGHG1, IGHA1). It would be nice to also load that info…
-
## 📚 Documentation
Hi,
I'm reading in 10x scTCR data processed via `cellranger` and using `trackClonotypes` to tabulate and plot proportions across samples. Is there documentation somewhere about ho…
-
It is currently possible for sequences that are missing required parts of certain gene segments to evade the parts of our pipeline that filter out of frame TCRs. For instance: AAGGCCCTGCCCAGCTAATCTTAA…
-
Here is a simulated IGH sample (using simNGS):
[igh.fa.txt](https://github.com/mozack/vdjer/files/805783/igh.fa.txt) - simulated IGH transcripts
[r1.fastq.txt](https://github.com/mozack/vdjer/fi…
-
Chère Juliana,
J'ai mis la sortie de vidjil sur les clonotypes simulés que tu m'as donné, sous forme:
clonotype number___ V type___D type___J type___occurance in clonotype
C1_______________ Vx__…
-
## Checklist before submitting the issue:
- [X] The issue is strongly related to the MiXCR software
- [X] The issue can be reproduced with [the most recent version](https://github.com/milaborato…