-
I have used direct RNA-seq ONT long reads data. while running the rnabloom2, I got an error in the assembly step. I am not getting the reason behind it. could you help me out? I have pasted the comma…
-
Hello,
If I wanted to do exact k-mer comparisons between genome assemblies could I simple use `sourmash sketch` with `scaled=1`?
Is this a stupid thing to do?
I have a limited set of bacterial…
-
I have a large list of fastq files that will be used for the same database.
Is there a simple way to run the command on a list of files for the same Meryl database or do I need to concatenate all o…
-
Hi,
After finding some relevant consecutive 31-mers, we would like to repeat the workflow with k=41 in order to focus our search. The template config.yaml discourages this, and it becomes clear fr…
-
Hello,
I am getting an error while indexing of the BAM files. I have installed the tool using conda. So the kallisto version is at 0.44 as mentioned. Below is STDOUT
```
Results stored in: stra…
-
Hi,
I have noticed that kmc tool (latest release) generates wrong k-mers for long (>= 32) reads and short reads (~5) as well.
For example:
AACCACAGATATCTTTAACCAGGATACCATAGAC
the following sh…
-
Dear developers,
this really is not a typical "issue" but rather an "enhancement"...
Would it be possible to add the amount of unique k-mers for a specific read classified into the kraken output…
-
per our last R01 submission,
>We will implement amino acid and Dayhoff-6 queries with spacegraphcats by building secondary indices on top of the cDBG unitigs, which will allow us to anchor protein …
-
Hello
I would like to count equally spaced k-mers.
e.g.) in-frame k-mers (such as codons or bi-codons) with step size 3.
Is it possible with Jellyfish?
Thank you
-
So after trying to write some code interfacing `kmers` with some k-mers parsed using `needletail`, I realized we are storing the k-mers in the opposite order. In `kmers` the leftmost nucleotide is st…
rob-p updated
2 years ago